We use cookies to improve security, personalize the user experience, enhance our marketing activities (including cooperating with our marketing partners) and for other business use.
Click "here" to read our Cookie Policy. By clicking "Accept" you agree to the use of cookies. Read less
Read more
Accept
Loading
Form preview
  • US Legal Forms
  • Form Library
  • More Forms
  • More Uncategorized Forms
  • Pet 16b Vector

Get Pet 16b Vector

TB046 2/00 pET-16b Vector The pET-16b vector (Cat. No. 69662-3) carries an N-terminal His Tag sequence followed by a Factor Xa site and three cloning sites. Unique sites are shown on the circle map.

How it works

  1. Open form

    Open form follow the instructions

  2. Easily sign form

    Easily sign the form with your finger

  3. Share form

    Send filled & signed form or save

Tips on how to fill out, edit and sign Bpu1102 online

How to fill out and sign AlwNI online?

Get your online template and fill it in using progressive features. Enjoy smart fillable fields and interactivity. Follow the simple instructions below:

Experience all the advantages of submitting and completing legal documents on the internet. Using our platform completing Pet 16b Vector usually takes a few minutes. We make that possible by giving you access to our feature-rich editor capable of transforming/correcting a document?s original textual content, adding special boxes, and e-signing.

Fill out Pet 16b Vector in just a few minutes by simply following the recommendations listed below:

  1. Choose the document template you need from the library of legal form samples.
  2. Choose the Get form button to open the document and move to editing.
  3. Complete the requested fields (they are yellow-colored).
  4. The Signature Wizard will enable you to add your electronic autograph right after you have finished imputing details.
  5. Put the date.
  6. Look through the whole form to be certain you have filled in everything and no corrections are required.
  7. Hit Done and download the resulting document to your gadget.

Send the new Pet 16b Vector in an electronic form when you finish completing it. Your data is well-protected, since we adhere to the latest security criteria. Become one of millions of satisfied users who are already completing legal documents right from their apartments.

How to edit BfaI: customize forms online

Go with a rock-solid document editing service you can trust. Revise, complete, and certify BfaI securely online.

Very often, modifying documents, like BfaI, can be pain, especially if you got them online or via email but don’t have access to specialized tools. Of course, you can use some workarounds to get around it, but you risk getting a document that won't fulfill the submission requirements. Utilizing a printer and scanner isn’t a way out either because it's time- and resource-consuming.

We provide an easier and more efficient way of modifying forms. A rich catalog of document templates that are straightforward to edit and certify, making fillable for others. Our platform extends way beyond a set of templates. One of the best aspects of using our option is that you can revise BfaI directly on our website.

Since it's an online-based service, it spares you from having to download any computer software. Additionally, not all company rules allow you to download it on your corporate computer. Here's the best way to effortlessly and securely complete your forms with our solution.

  1. Click the Get Form > you’ll be immediately redirected to our editor.
  2. Once opened, you can kick off the editing process.
  3. Select checkmark or circle, line, arrow and cross and other options to annotate your form.
  4. Pick the date option to add a particular date to your template.
  5. Add text boxes, graphics and notes and more to enrich the content.
  6. Utilize the fillable fields option on the right to create fillable {fields.
  7. Select Sign from the top toolbar to create and create your legally-binding signature.
  8. Hit DONE and save, print, and share or download the output.

Forget about paper and other ineffective methods for modifying your BfaI or other documents. Use our tool instead that includes one of the richest libraries of ready-to-edit forms and a robust document editing option. It's easy and safe, and can save you lots of time! Don’t take our word for it, try it out yourself!

Get form

Experience a faster way to fill out and sign forms on the web. Access the most extensive library of templates available.
Get form

Xba Related content

Cloning, Expression, and Purification of...
Jan 27, 2016 — The gene was cloned into the expression vector pET16b through NdeI...
Learn more
pET16b - DNASU Plasmid | Detailed Vector...
Bacterial expression vector with a T7 promoter and Factor Xa cleavable N-terminal 6xHis...
Learn more
Engineering Strategy Overview Preliminary...
signal analysis requires vector processing. ... ____ ~ _ Com pet ito r : ______ it c...
Learn more

Related links form

PA PA/CS 611 2006 PA Penn Mutual PM6532 2014 PA RASP SC DHHS Form 913 2009

TB046 Questions & Answers

Get answers to your most pressing questions about US Legal Forms API.

Contact support

The pET System is the most powerful system yet developed for the cloning and expression of recombinant proteins in Escherichia coli Target genes are cloned in pET plasmids under control of strong bacteriophage T7 transcription and (optionally) translation signals, expression is induced by providing a source of T7 RNA ...

pET-28a is a commonly used fusion protein type prokaryotic high-efficient expression vector, which contains resistance gene. Expression is induced by T7 RNA polymerase provided by the host cell. Host bacteria: It is recommended to clone E. coli DH5a or TOP10 as the recipient bacteria; use E.

The pET vector exists as a low copy number plasmid in host E. coli, which reduces leaky expression before induction. The vector utilizes the T7lac promoter system for strong and tightly controlled gene expression.

pET vector is an expression vector used for the expression of recombinant protein in E. coli.

The pET vector system is a powerful and widely used system for expressing recombinant proteins in E. coli. The gene of interest is cloned into the pET vector under the control of the strong bacteriophage T7 transcription and translation regulatory system.

pET vector is an expression vector used for the expression of recombinant protein in E. coli. This vector system utilizes the T7 lac promoter system for controlled gene expression. It is also called as Bacterial Recombinant Protein Vector.

Overview. The pET-16b vector carries an N-terminal His•Tag® sequence followed by a Factor Xa site and three cloning sites. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the vector map (TB046). The pET Vectors are supplied as purified plasmid DNA (10 µg).

pET plasmid (plural pET plasmids) Any of a family of vectors for protein expression where the expression of the insert DNA is controlled by the T7 promoter, a phage promoter.

Salient features of pET28a, design flaws and improved designs a Genetic elements present in pET28a include the φ10 (T7) promoter and the lac operator, as well as the translation initiation region (TIR) encompassing the Shine–Dalgarno (SD) sequence, a spacer and the first five codons of the coding sequence.

Get This Form Now!

Use professional pre-built templates to fill in and sign documents online faster. Get access to thousands of forms.
Get form

Keywords relevant to Pet 16b Vector

  • pBR322
  • laci
  • Novagen
  • 1878
  • xa
  • 1893
  • TB046
  • Xba
  • Bpu1102
  • bgl
  • CGAAAGGAAGCTGAGTTGGCTGCTGCCACC
  • AlwNI
  • BfaI
  • BsgI
  • BsrBI
If you believe that this page should be taken down, please follow our DMCA take down processhere.

Industry-leading security and compliance

US Legal Forms protects your data by complying with industry-specific security standards.
  • In businnes since 1997
    25+ years providing professional legal documents.
  • Accredited business
    Guarantees that a business meets BBB accreditation standards in the US and Canada.
  • Secured by Braintree
    Validated Level 1 PCI DSS compliant payment gateway that accepts most major credit and debit card brands from across the globe.
Get Pet 16b Vector
Get form
Form Packages
Adoption
Bankruptcy
Contractors
Divorce
Home Sales
Employment
Identity Theft
Incorporation
Landlord Tenant
Living Trust
Name Change
Personal Planning
Small Business
Wills & Estates
Packages A-Z
Form Categories
Affidavits
Bankruptcy
Bill of Sale
Corporate - LLC
Divorce
Employment
Identity Theft
Internet Technology
Landlord Tenant
Living Wills
Name Change
Power of Attorney
Real Estate
Small Estates
Wills
All Forms
Forms A-Z
Form Library
Customer Service
Terms of Service
DMCA Policy
About Us
Blog
Affiliates
Contact Us
Privacy Notice
Delete My Account
Site Map
All Forms
Search all Forms
Industries
Forms in Spanish
Localized Forms
Legal Guides
Real Estate Handbook
All Guides
Prepared for You
Notarize
Incorporation services
Our Customers
For Consumers
For Small Business
For Attorneys
Our Sites
US Legal Forms
USLegal
FormsPass
pdfFiller
signNow
airSlate workflows
DocHub
Instapage
Social Media
Call us now toll free:
1-877-389-0141
As seen in:
  • USA Today logo picture
  • CBC News logo picture
  • LA Times logo picture
  • The Washington Post logo picture
  • AP logo picture
  • Forbes logo picture
© Copyright 1997-2025
airSlate Legal Forms, Inc.
3720 Flowood Dr, Flowood, Mississippi 39232
Form Packages
Adoption
Bankruptcy
Contractors
Divorce
Home Sales
Employment
Identity Theft
Incorporation
Landlord Tenant
Living Trust
Name Change
Personal Planning
Small Business
Wills & Estates
Packages A-Z
Form Categories
Affidavits
Bankruptcy
Bill of Sale
Corporate - LLC
Divorce
Employment
Identity Theft
Internet Technology
Landlord Tenant
Living Wills
Name Change
Power of Attorney
Real Estate
Small Estates
Wills
All Forms
Forms A-Z
Form Library
Customer Service
Terms of Service
DMCA Policy
About Us
Blog
Affiliates
Contact Us
Privacy Notice
Delete My Account
Site Map
All Forms
Search all Forms
Industries
Forms in Spanish
Localized Forms
Legal Guides
Real Estate Handbook
All Guides
Prepared for You
Notarize
Incorporation services
Our Customers
For Consumers
For Small Business
For Attorneys
Our Sites
US Legal Forms
USLegal
FormsPass
pdfFiller
signNow
airSlate workflows
DocHub
Instapage
Social Media
Call us now toll free:
1-877-389-0141
As seen in:
  • USA Today logo picture
  • CBC News logo picture
  • LA Times logo picture
  • The Washington Post logo picture
  • AP logo picture
  • Forbes logo picture
© Copyright 1997-2025
airSlate Legal Forms, Inc.
3720 Flowood Dr, Flowood, Mississippi 39232