Name Restriction Enzyme Worksheet 1 From City Lab s Case of the Missing Crown Jewels. Trustees of Boston University A natural enemy of bacteria is a virus. To defend themselves when attacked by a virus bacteria use chemical weapons that break up the DNA of the virus. The action of the chemicals on the viral DNA is shown in the diagram 1 below DNA from virus cut TACCGGGAATTCATCCGGTGAATTCTAGCGTAC ATGGCCCTTAAGTAGGCCACTTAAGATCGCATG TACCGGG AATTCATCCGGTG GTAGGCCACTTAA AATTCTAGCGTAC GATCGCATG Use the diagram above to answer the following questions 1. The chemical that cuts the DNA is called a. 2. These enzymes cut the DNA which creates different sized. 3. The restriction enzyme used above is called EcoRI. EcoRI cuts DNA everywhere the base pattern is. 4. Another restriction enzyme is called HaeIII. It cuts DNA at the following base sequence CCGG GGCC Show the DNA fragments that would result if HaeIII was used to cut the DNA fragment shown in the first diagram above. Do you think restriction ....
Open form follow the instructions
Easily sign the form with your finger
Send filled & signed form or save
How to fill out the Restriction Enzyme Worksheet Answer Key online
Filling out the Restriction Enzyme Worksheet Answer Key online can enhance your understanding of the topic and streamline the process. This guide will walk you through each step to ensure accurate and efficient completion of the form.
Follow the steps to complete the Restriction Enzyme Worksheet Answer Key online
- Click the ‘Get Form’ button to obtain the form and open it in the editor.
- Begin by entering your name in the designated field to identify your submission.
- Input the current date in the space provided, ensuring the format is clear and appropriate.
- Refer to the diagram and answer question 1 by specifying the chemical that cuts the DNA.
- For question 2, indicate what different sized items are created when the DNA is cut.
- In question 3, insert the specific base pattern that EcoRI recognizes and cuts.
- Question 4 requires you to illustrate the DNA fragments that would appear if HaeIII was utilized according to the given base sequence.
- Provide a thoughtful response to question 5 regarding the potential use of restriction enzymes on DNA from other organisms.
- Answer question 6 by defining palindromes, relating your answer to how they apply to the context.
- Lastly, for question 7, explain the role of palindromes in the function of restriction enzymes when cutting double-stranded DNA.
- Once all fields and questions are completed, review your answers for accuracy. Save your changes, and then download, print, or share the completed worksheet as needed.
Take the first step to enhance your learning by completing the Restriction Enzyme Worksheet Answer Key online.
Experience a faster way to fill out and sign forms on the web. Access the most extensive library of templates available.
Related content
engineering answer key section re effectively. Focus on Key Terminology. Terms like...
Restriction enzymes are extensively used in molecular biology. Below are the recognition...
If the DNA molecule has two restriction sites, for restriction enzyme A, how many...
Get answers to your most pressing questions about US Legal Forms API.
What is a short answer to restriction enzyme?
A restriction enzyme is a protein that cuts DNA at specific sequences, which is crucial for various genetic engineering techniques. Understanding how they work is essential in molecular biology. For an in-depth exploration of these concepts, the Restriction Enzyme Worksheet Answer Key serves as a valuable resource, providing insight and clarity on their applications.
How to write restriction enzymes?
Writing restriction enzymes involves specifying the enzyme name, the recognition sequence, and the cut location in the DNA. It is essential to provide clear details so that others can replicate your methods. The Restriction Enzyme Worksheet Answer Key offers templates for documenting this information accurately, making it easy to communicate your findings to peers.
How to solve restriction enzyme problems?
Solving restriction enzyme problems involves understanding the DNA sequence and the enzymes' recognition sites. Begin by reviewing the sequences in your experiment and consult the restriction map if available. Using the Restriction Enzyme Worksheet Answer Key can help clarify the solutions, guiding you step-by-step through the process of identifying cuts and understanding outcomes.
How to calculate how much restriction enzyme to use?
To determine the correct amount of restriction enzyme, first identify the target DNA concentration and the specific enzyme activity unit required for your experiment. Generally, you would use a standard formula where you multiply the volume of the reaction by the recommended enzyme units. For more intricate calculations, refer to our Restriction Enzyme Worksheet Answer Key, which simplifies the process and ensures accurate results.
What is restriction enzyme key points?
A restriction enzyme is a protein isolated from bacteria that cleaves DNA sequences at sequence-specific sites, producing DNA fragments with a known sequence at each end. The use of restriction enzymes is critical to certain laboratory methods, including recombinant DNA technology and genetic engineering.
What is a restriction enzyme select the single best answer?
A restriction enzyme is a DNA-cutting enzyme that recognizes specific sites in DNA. Many restriction enzymes make staggered cuts at or near their recognition sites, producing ends with a single-stranded overhang. If two DNA molecules have matching ends, they can be joined by the enzyme DNA ligase.
What is a restriction enzyme simple definition?
A restriction enzyme is a protein isolated from bacteria that cleaves DNA sequences at sequence-specific sites, producing DNA fragments with a known sequence at each end. The use of restriction enzymes is critical to certain laboratory methods, including recombinant DNA technology and genetic engineering.
What are the 5 restriction enzymes?
Naturally occurring restriction endonucleases are categorized into five groups (Types I, II, III, IV, and V) based on their composition and enzyme cofactor requirements, the nature of their target sequence, and the position of their DNA cleavage site relative to the target sequence.
What are the types of restriction enzymes?
Types of Restriction Enzymes Type I. These restriction enzymes cut the DNA far from the recognition sequences. ... Type II. These enzymes cut at specific positions closer to or within the restriction sites. ... Type III. These are multi-functional proteins with two subunits- Res and Mod. ... In Gene Cloning.
What is restriction enzyme PDF?
Restriction enzyme is a protein (nuclease) that recognizes a specific, short nucleotide sequence of DNA (known as restriction site or target sequence or recognition sequence) and then cuts the DNA only at that specific site.
Use professional pre-built templates to fill in and sign documents online faster. Get access to thousands of forms.
If you believe that this page should be taken down, please follow our DMCA take down process here.